FISH/GISH

Probes for Fluorescence in situ Hybridisation

All probes are made by labelling DNA template using the nick translation protocol for ‘Large chromosomal targets’ in Kato et al. (2011), with minor modifications (see below).

DNA-based probes for fluorescence in situ hybridisation (FISH) to Tragopogon chromosomes have been made from three different types of DNA template. These are:

• Total-genomic-DNA (i.e., for “genomic in situ hybridisation” GISH) Double-stranded oligonucleotides (dsDNA oligo probes) (e.g., for FISH localisation of tandem repeats)
• PCR-amplified sequences (e.g., for FISH localisation of 18S rDNA)

Notes on Probe Template Synthesis and Labelling

Total Genomic DNA

Input for nick translation is gDNA that has been extracted, RNase A-treated and purified using the DNeasy Kit following the protocol in the previous section. Genomic DNA should be stored at -20 ⁰ C. The amount of gDNA template that should be labeled in the nick translation reaction is 500 ng (instead of 5000 ng).

The final concentration of the probe, after labelling, will therefore be 10 ng/gl.

dsDNA Oligo Probes

We purchase our unmodified DNA oligonucleotides from Eurofins MWG Operon (Huntsville, AL, USA) at the 10 nM scale, which is limited to a maximum length of 60 bp. This is the same service that we use for standard PCR primers.

Oligonucleotides should be made double-stranded in the following way:

 Dry oligonucleotides should be suspended in water to give a final concentration of 100 gM (following the manufacturers guidance).

 Combine equal volumes of complementary oligonucleotides in a 0.2 ml PCR tube and heat to 95 ⁰ C for 5 min in a PCR machine.

 Tubes should then immediately be transferred to a beaker containing 400 ml of 90 ⁰ C water (heated in a microwave) and left to cool slowly until the water         temperature reaches approximately 35 ⁰ C. This gradual cooling allows dsDNA to form.

-The resulting dsDNA can be quantified using a spectrophotometer. Once made, dsDNA oligos can be stored at -20 ⁰ C. 5 ug of dsDNA oligo (typically 4 UI) should be used as input for the nick translation reaction.

PCR-amplified Sequences

In most cases a plasmid-cloned sequence is used as a template. For example to paint the 35S rDNA regions we have used a 1333 bp 18S rDNA sequence cloned from Tragopogon dubius (clone number: 17.1, vector: pSC-A-amp/kan). To obtain a large amount of product, several 100 gl PCR reactions can be carried out in one go. For a 100 gl PCR reaction 3 to 5 ng of plasmid DNA will provide sufficient template (we add 3.5 Ill of 1:100-diluted plasmid, original plasmid concentration is about 100 ng/gl). Standard reagent concentrations should be used together with 10 % (v/v) 5M betaine.

Primers for the amplification of 18S clone (clone: 17.1) are:

TGTGCCGGCGACGCATCATT

GCGAGCTGATGACTCGCGCT

PCR Program for 18S clone amplification:

94⁰ C 2 min, then 38 cycles of: 94⁰ C for 1 min, 60 ⁰ C for 40 sec, 72 ⁰ C for 40 sec and 72 ⁰ C for 1 min 20 sec followed by a final extension of: 72 ⁰ C for 4 min.

PCR products should be run on an agarose gel and then pooled and precipitated using: 0.1 volumes of 3 M sodium acetate pH 5.2 and 2.5 volumes of 100% ethanol, mixing and then incubating overnight at -20 ⁰ C. The mixture should then be centrifuged for 25 min at max speed. The pellet can be washed with 70%, then 100% ethanol and then air dried. Pellet can be eluted in TE or Tris buffer. The resulting dsDNA should be quantified using a spectrophotometer. Stocks can be can be stored at *20 ⁰ C. 5 ug of dsDNA oligo should be used as input for the nick translation reaction.

Nick Translation

This is a 2 hr reaction carried out at 15 ⁰ C. See Kato et al. (2011) for details.

Example Nick Translation Components for labeling 18S rDNA PCR product:

4.6 PI (5000 ng) 18S rDNA PCR product

5 PI of 5x Nick Translation Buffer

5 PI of dATP, dCTP and dGTP nucleotides all 2 mM

27.4 gl water

1 gl dUTP-fluorescein

6.25 PI of 10 U/gl DNA Polymerase I

1 PI of 100 mU/!ll DNase I

Total: 50.25 UI

After labeling, the reaction can be terminated by freezing the samples to -20 ⁰ C.

 

Probe purification

All probes are cleaned using a Qiagen QIAquick nucleotide removal kit. For the final step in the cleaning procedure 54 111 of Elution Buffer should be added to the column to recover 50 gl of probe.

Reference

Akio Kato, Jonathan C. Lamb, Patrice S. Albert, Tatiana Danilova, Fangpu Han, Zhi Gao, Seth Findley, and James A. Birchler. Plant Chromosome Engineering: Methods and Protocols, Methods in Molecular Biology, 2011, Vol. 701, Chapter 4)pp. 68-69.

Chromosome Preparation and FISH

This method based on that described in Birchler et ali Tropical Plant Biology, 2008, 1:34-39 and Kato et al. Plant Chromosome Engineering: Methods and Protocols, Methods in Molecular Biology, 2011, Vol. 701, Chapter 4.

Root Pretreatment and Fixation

In advance, dissolve 0.145 g of 8-hydroxyquinoline in 500 ml of distilled water at 60 ⁰ C on a magnetic stirrer for 3-6 h, to give a concentration of 2 mM. Once fully dissolved, store the solution in the dark (the solution is light sensitive) at 4⁰ C. We cover the 8HQ stock bottle with foil and store it in the refrigerator.

• Using forceps remove the final 2 cm of root and immerse in 2 mM 8hydroxyquinoline. Using a 2 ml Eppendorf tube containing 1 ml 8HQ works well.
• Incubate at 4⁰ C in the dark, for 5-20 hours. We have collected roots from Tragopogon species late in the day (4 pm – 6 pm) and pretreated them overnight until 8 am -10 am the following day. The optimal collection time may be different for other species and should be tested.
• Remove 8-hydroxyquinoline and add ice-cold 90 % acetic acid and incubate on ice for 10 minutes.

 Remove 90% acetic acid and add 70 % ethanol, store at -20 ⁰ C.

Root Tip Digestion

– Immerse roots in Ix citric buffer, on ice, for 10 min. Repeat twice more.

 If possible, remove the root cap, then cut the meristematic region from the remainder of the root with a razor blade. (Thicker roots can be cut into 0.5 mm long pieces to improve enzyme digestion).  Discard the root cap and remove the differentiated region behind the meristematic region–retain only the meristematic region, which can be cut in half.

 Transfer the dissected root tip to 0.2 ml PCR tube containing 20 UI of enzyme mix (1% pectolyase Y23 and 2% cellulase, in Ix citric buffer).

• Incubate for 46 min at 37 ⁰ (Incubation time will vary depending on root structure and size.)
• After digestion, transfer tube to ice.

 Carefully wash roots with ice-cold 70% ethanol. Repeat twice more, or until the enzyme suspension is no longer visible.

 Remove ethanol from tube, leaving about 2 PI behind. (This will help to prevent the acetic acid from freezing.)

 Add 27 gl of glacial acetic acid, return tube to ice.

• Break up tissue with a blunt dissecting needle and then rest tube on ice.

Chromosome Spreading

 Mist the inside of the cardboard humid chamber and a half-folded Kimwipe.

• Place slides in the humid chamber and pipette two 3.5 gl droplets of cell suspension onto each slide (see number positions in slide cartoon). Breathing on each slide after pipetting the suspension helps to increase the humidity, immediately cover box with damp Kimwipe to maintain humidity.
• Incubate slides for 7-10 min in the covered humidity chamber.

 Remove slides from chamber, allow to air dry and check preparations with phase contrast microscope.

• Mark good chromosome spreads (i.e., those that are complete, have sufficiently compressed chromosomes and have no overlapping chromosomes) with a marker pen on the underside of the slide.

 Slides can be left at room temperature for a few hours or placed in a slide box and stored at -20 ⁰ C for longer term storage.

• Prepared slides are best used within a few days of being made. Longer-term storage typically results in chromatin degradation observable as a loss of glossiness or shininess.

Fluorescence in situ Hybridization

• Prepare metallic tray with a layer of wet Kimwipes.

 Select slides for FISH. Slides should be allowed to warm to room temperature after removal from the freezer before taking them out of their storage container. This will prevent condensation forming on the slide.

• UV cross-link slides (apply 120 mJ/cm ²).
• Probes are light sensitive. Work under IQU_ljght.

 Pipette one drop of hybridization mix on the target area of the slide (*example mixes below).

• Place coverslip on droplet.
• Transfer slides to metal tray, cover, and denature for 2.5 min at 83 ⁰
• Transfer slides to a plastic lightproof humid box, leave to hybridize at 55 ⁰ C overnight for FISH (16 hrs) and two days for GISH (36 hrs).

*Example FISH Mix Components for Tragopogon species: 3 gl (150 ng) TTR3 fluorescein-labeled probe 3.5 PI (175 ng) TPRMBO Cy5-labe1ed probe 1.8 PI (90 ng) TGP7 Cy3-labeled probe 0.4 gl mix of 18S rDNA Cy3-labeled and fluorescein-labeled probe (20 ng + 20 ng) 5 gl (700 ng) sheared salmon sperm DNA in 2x SSC, Ix TE buffer 2x SSC, Ix TE buffer to 10.5 Lil

*Example GISH Mix Components for Tragopogon miscellus: 4 gl (40 ng) T. pratensis gDNA Cy3-labeled probe 4 ul (40 ng) T. dubius gDNA fluorescein-labeled probe 4 PI 560 ng sheared salmon sperm DNA

Post-Hybridization Coverslip Removal and Slide Wash

• To remove coverslips, place slides to a Coplin jar containing 55 ⁰ C 2x SSC.
• Remove slides and use a Kimwipe to blot excess 2x SSC.
• Without allowing slides to dry out, add a drop of Vectashield and mount a 22 x 40 mm coverslip (coverslip thickness needs to be: “1 h”).
• Gently blot away any excess Vectashield using Whatman chromatography paper and store slides in the refrigerator.
• Slides are best viewed at least several hours after stabilization in the refrigerator.